Brevinema andersonii (Brev. i. ne' ma. L. adj. brevis, short; Gr. n. nema, thread; N.L. neut. n. Brevinema, a short thread.) (an.derso'ni.i. N.L. gen. n. andersonii, of Anderson), named for John F. Anderson, who first described the organism.[1] This organism is a Gram-negative, microaerophilic, helical shaped, chemoorganotrophic organism from the genus Brevinema.[2]Brevinema andersonii is host associated, strains have been isolated from blood and other tissues of short-tailed shrews (Blarina brevicauda) and white-footed mice (Peromyscus Zeucopus) and are infectious for laboratory mice and Syrian hamsters.[1][2]B. andersonii is readily identified by restriction enzyme analysis, and SDS-PAGE, or fatty acid composition data. Another identifier for B. andersonii is the sheathed periplasmic flagella in the 1-2-1 configuration. While cells are visible by dark-field or phase-contrast microscopy, they cannot be seen when bright-field microscopy is used.[1]
Brevinema andersonii was first identified in 1987 by Anderson F. John, Russell C. Johnson, Louis A.Magnarell, Fred W. Hyde, and Theodore G Andreadis in blood and tissues from Blarina brevicauda (short-tailed shrew) and Peromyscus leucopus (white-footed mouse).[2] Initially thought to be associated with Borrelia burgdorferi this organism was finally brought to light with more advanced growth mediums. Upon electron microscopy of cultures from this medium, a distinct morphology stood out from the rest.[2] It was not until 1995 that a push for this organism to be found as a new species. This push came as an article from the Journal of Systematic Bacteriology that exclaimed data supports this organism to be its own genus species was broadcast. Written by D.L. Defosse, R. C. Johnson, B. J. Paster, F. E. Dewhirst, they found genomic evidence to support their claim that Brevienma andersonii was its own deep rooted spirochete. Their findings showed that this organism was around 75% similar in genome to other known spirochetes, this showed that B. andersonii was in a taxon of its own.[1][2]
Biology and Biochemistryedit
Type and morphologyedit
Brevinema andersonii stains as G- due to the peptidoglycan in the triple-layered outer membrane. Its metabolism is chemoorganotrophic. The organism exists in microaerophilic environments. B. andersonii is a motile and flexible helical shaped spiral bacteria that possess a triple-layered outer envelope.[1] Between the outer membrane and the peptidoglycan layer there is a single sheathed flagella in the 1-2-1 configuration, as well as a protoplasmic cylinder.[1] The cells are usually 0.2–0.3μm in diameter and 4-5μm in length.[1] 1–2 waves occur along the cell with wavelengths of 2-3μm.[1] The typical final density of the cells are around 4x10−7 cells per milliliter.[1]
Brevenima andersonii was found to be grown successfully on a modified BSK medium, referred to as shrew-mouse spirochete medium. The optimum temperature range that B. andersonii grows at is between 30 °C to 34 °C, but B. andersonii cannot grow below 25 °C. The ideal pH for B. andersonii is neutral with an optimum pH of 7.4. It takes 11 to 14 hours per generation time at optimum conditions.
Genomeedit
The type strain of Brevinema andersonii was designated as ATCC 43811.[1] The G+C content of this organism was fount t be 34 mol%.[1] Unique single-base nucleotide signatures at positions 52•359 (G•C) and 783•799 (U•A) differentiate B. andersonii from other major spirochete groups.[1] There is also a distinguishing 16S rRNA sequence that corresponds to position 724 to 750 in E. coli (5'-GGCAGCUACCUAUGCUAAGAUUGACGC-3').[1] The 16S rRNA genome is extracted was a partial genome with 1490 bp,[1] the 16S rRNA partial genome reads as:[3]
Referencesedit
^ abcdefghijklmnopqDEFOSSE, D. L.; JOHNSON, R. C.; PASTER, B. J.; DEWHIRST, F. E.; FRASER, G. J. (1995). "Brevinema andersonii gen. nov., sp. nov., an Infectious Spirochete Isolated from the Short-Tailed Shrew (Blarina brevicauda) and the White-Footed Mouse (Peromyscus leucopus)". International Journal of Systematic Bacteriology. 45 (1): 78–84. doi:10.1099/00207713-45-1-78. PMID 7857811.
^ abcdeAnderson, John F.; Johnson, Russell C.; Magnarelli, Louis A.; Hyde, Fred W.; Andreadis, Theodore G. (Aug 1987). "New Infectious Spirochete Isolated from Short-Tailed Shrews and White-Footed Mice". American Society for Microbiology. 25 (8): 1490–4. doi:10.1128/JCM.25.8.1490-1494.1987. PMC269255. PMID 3305565.
Anderson, JF; Johnson, RC; Magnarelli, LA; Hyde, FW; Andreadis, TG (1987). "New infectious spirochete isolated from short-tailed shrews and white-footed mice". J. Clin. Microbiol. 25 (8): 1490–4. doi:10.1128/JCM.25.8.1490-1494.1987. PMC269255. PMID 3305565.
April 13, 2024
brevinema, andersonii, brev, brevis, short, nema, thread, neut, brevinema, short, thread, derso, andersonii, anderson, named, john, anderson, first, described, organism, this, organism, gram, negative, microaerophilic, helical, shaped, chemoorganotrophic, orga. Brevinema andersonii Brev i ne ma L adj brevis short Gr n nema thread N L neut n Brevinema a short thread an derso ni i N L gen n andersonii of Anderson named for John F Anderson who first described the organism 1 This organism is a Gram negative microaerophilic helical shaped chemoorganotrophic organism from the genus Brevinema 2 Brevinema andersonii is host associated strains have been isolated from blood and other tissues of short tailed shrews Blarina brevicauda and white footed mice Peromyscus Zeucopus and are infectious for laboratory mice and Syrian hamsters 1 2 B andersonii is readily identified by restriction enzyme analysis and SDS PAGE or fatty acid composition data Another identifier for B andersonii is the sheathed periplasmic flagella in the 1 2 1 configuration While cells are visible by dark field or phase contrast microscopy they cannot be seen when bright field microscopy is used 1 Brevinema andersoniiScientific classificationDomain BacteriaPhylum SpirochaetotaClass SpirochaetiaOrder BrevinematalesGupta et al 2014Family BrevinemataceaePaster 2012Genus BrevinemaDefosse et al 1995Species B andersoniiBinomial nameBrevinema andersoniiDefosse et al 1995 Contents 1 History 2 Biology and Biochemistry 2 1 Type and morphology 2 2 Biochemistry 2 3 Growth 3 Genome 4 References 5 External linksHistory editBrevinema andersonii was first identified in 1987 by Anderson F John Russell C Johnson Louis A Magnarell Fred W Hyde and Theodore G Andreadis in blood and tissues from Blarina brevicauda short tailed shrew and Peromyscus leucopus white footed mouse 2 Initially thought to be associated with Borrelia burgdorferi this organism was finally brought to light with more advanced growth mediums Upon electron microscopy of cultures from this medium a distinct morphology stood out from the rest 2 It was not until 1995 that a push for this organism to be found as a new species This push came as an article from the Journal of Systematic Bacteriology that exclaimed data supports this organism to be its own genus species was broadcast Written by D L Defosse R C Johnson B J Paster F E Dewhirst they found genomic evidence to support their claim that Brevienma andersonii was its own deep rooted spirochete Their findings showed that this organism was around 75 similar in genome to other known spirochetes this showed that B andersonii was in a taxon of its own 1 2 Biology and Biochemistry edit nbsp Type and morphology edit Brevinema andersonii stains as G due to the peptidoglycan in the triple layered outer membrane Its metabolism is chemoorganotrophic The organism exists in microaerophilic environments B andersonii is a motile and flexible helical shaped spiral bacteria that possess a triple layered outer envelope 1 Between the outer membrane and the peptidoglycan layer there is a single sheathed flagella in the 1 2 1 configuration as well as a protoplasmic cylinder 1 The cells are usually 0 2 0 3mm in diameter and 4 5mm in length 1 1 2 waves occur along the cell with wavelengths of 2 3mm 1 The typical final density of the cells are around 4x10 7 cells per milliliter 1 Biochemistry edit nbsp Brevinema andersonii can be readily identified by enzyme analysis and SDS PAGE or fatty acid composition data An enzyme analysis of B andersonii showed activity with butyrate valerate caproate caprylate nonanoate caprate esterase lipase alkaline phosphatase acid phosphatase and b glucuronidase 1 The fatty acid composition mainly consists of myristic acid 14 0 palmitic acid 16 0 and oleic acid 18 l and smaller amounts of stearic acid 18 1 and linoleic acid 18 2 1 There were low levels less than 1 of other fatty acids detected B andersonii was found to be catalase negative 1 nbsp Growth edit Brevenima andersonii was found to be grown successfully on a modified BSK medium referred to as shrew mouse spirochete medium The optimum temperature range that B andersonii grows at is between 30 C to 34 C but B andersonii cannot grow below 25 C The ideal pH for B andersonii is neutral with an optimum pH of 7 4 It takes 11 to 14 hours per generation time at optimum conditions Genome editThe type strain of Brevinema andersonii was designated as ATCC 43811 1 The G C content of this organism was fount t be 34 mol 1 Unique single base nucleotide signatures at positions 52 359 G C and 783 799 U A differentiate B andersonii from other major spirochete groups 1 There is also a distinguishing 16S rRNA sequence that corresponds to position 724 to 750 in E coli 5 GGCAGCUACCUAUGCUAAGAUUGACGC 3 1 The 16S rRNA genome is extracted was a partial genome with 1490 bp 1 the 16S rRNA partial genome reads as 3 References edit a b c d e f g h i j k l m n o p q DEFOSSE D L JOHNSON R C PASTER B J DEWHIRST F E FRASER G J 1995 Brevinema andersonii gen nov sp nov an Infectious Spirochete Isolated from the Short Tailed Shrew Blarina brevicauda and the White Footed Mouse Peromyscus leucopus International Journal of Systematic Bacteriology 45 1 78 84 doi 10 1099 00207713 45 1 78 PMID 7857811 a b c d e Anderson John F Johnson Russell C Magnarelli Louis A Hyde Fred W Andreadis Theodore G Aug 1987 New Infectious Spirochete Isolated from Short Tailed Shrews and White Footed Mice American Society for Microbiology 25 8 1490 4 doi 10 1128 JCM 25 8 1490 1494 1987 PMC 269255 PMID 3305565 Brevinema andersonii strain ATCC 43811 16S ribosomal RNA gene partial Nucleotide NCBI www ncbi nlm nih gov 28 April 2010 Retrieved 2015 11 19 External links edithttps www ncbi nlm nih gov nuccore GU993264 NCBI data Anderson JF Johnson RC Magnarelli LA Hyde FW Andreadis TG 1987 New infectious spirochete isolated from short tailed shrews and white footed mice J Clin Microbiol 25 8 1490 4 doi 10 1128 JCM 25 8 1490 1494 1987 PMC 269255 PMID 3305565 Retrieved from https en wikipedia org w index php title Brevinema andersonii amp oldid 1123017612, wikipedia, wiki, book, books, library,