The transcription factorSp1 for example, binds the sequences 5'-(G/T)GGGCGG(G/A)(G/A)(C/T)-3', where (G/T) indicates that the domain will bind a guanine or thymine at this position.
A recognition sequence is different from a recognition site. A given recognition sequence can occur one or more times, or not at all, on a specific DNA fragment. A recognition site is specified by the position of the site. For example, there are two PstI recognition sites in the following DNA sequence fragment, starting at base 9 and 31 respectively. A recognition sequence is a specific sequence, usually very short (less than 10 bases). Depending on the degree of specificity of the protein, a DNA-binding protein can bind to more than one specific sequence. For PstI, which has a single sequence specificity, it is 5'-CTGCAG-3'. It is always the same whether at the first recognition site or the second in the following example sequence. For Sp1, which has multiple (16) sequence specificity as shown above, the two recognition sites in the following example sequence fragment are at 18 and 32, and their respective recognition sequences are 5'-GGGGCGGAGC-3' and 5'-TGGGCGGAAC-3'.
recognition, sequence, recognition, sequence, sequence, which, structural, motif, binding, domain, exhibits, binding, specificity, palindromes, transcription, factor, example, binds, sequences, gggcgg, where, indicates, that, domain, will, bind, guanine, thymi. A recognition sequence is a DNA sequence to which a structural motif of a DNA binding domain exhibits binding specificity Recognition sequences are palindromes 1 The transcription factor Sp1 for example binds the sequences 5 G T GGGCGG G A G A C T 3 where G T indicates that the domain will bind a guanine or thymine at this position The restriction endonuclease PstI recognizes binds and cleaves the sequence 5 CTGCAG 3 A recognition sequence is different from a recognition site A given recognition sequence can occur one or more times or not at all on a specific DNA fragment A recognition site is specified by the position of the site For example there are two PstI recognition sites in the following DNA sequence fragment starting at base 9 and 31 respectively A recognition sequence is a specific sequence usually very short less than 10 bases Depending on the degree of specificity of the protein a DNA binding protein can bind to more than one specific sequence For PstI which has a single sequence specificity it is 5 CTGCAG 3 It is always the same whether at the first recognition site or the second in the following example sequence For Sp1 which has multiple 16 sequence specificity as shown above the two recognition sites in the following example sequence fragment are at 18 and 32 and their respective recognition sequences are 5 GGGGCGGAGC 3 and 5 TGGGCGGAAC 3 5 AACGTTAGCTGCAGTCGGGGCGGAGCTAGGCTGCAGGAATTGGGCGGAACCT 3 See also edit nbsp Wikidata has the property nbsp recognition sequence P4863 see uses DNA binding domain Transcription factor Classes for more examplesReferences edit Gowers DM Bellamy SR Halford SE 2004 One recognition sequence seven restriction enzymes five reaction mechanisms Nucleic Acids Res 32 11 3469 79 doi 10 1093 nar gkh685 PMC 443551 PMID 15226412 nbsp This genetics article is a stub You can help Wikipedia by expanding it vte Retrieved from https en wikipedia org w index php title Recognition sequence amp oldid 1217653927, wikipedia, wiki, book, books, library,
