During transcription, the original template strand is usually read from the 3' to the 5' end from beginning to end. Subgenomic mRNAs are created when transcription begins at the 3' end of the template strand (or 5' of the to-be-newly synthesized template) and begins to copy towards the 5' end of the template strand before "jumping" to the end of the template and copying the last nucleotides of the 5' end of the template, (finishing the 3' tail for the newly created strand).
As a result, the translated strand will have a similar 5' end to varying degrees with the original template (depending on which part of the template the transcription jumped over) and a similar 3' end to the template.[1]
5' to 3' (positive sense) viral RNAedit
Positive-sense (5' to 3') viral RNA which may be directly translated into the desired viral proteins, undergoes a similar process as described in 3' to 5'. Portions of the viral RNA may be skipped during translation.
Resultedit
The result is that many different proteins can be created from the same mRNA strand, with similar 5' ends (to varying degrees) and same 3' ends. Or, different proteins can be created with positive sense viral RNA.
The 5' section on the newly created strand matches that of the template strand, and this section on the template strand is referred to as the "nested set".[2]
This complex method of transcription is generally restricted to viruses, especially those of the single-stranded, positive-sense RNA or Class IV viruses using the Baltimore Classification System, e.g. viruses of the order Nidovirales.
It is primarily used for compacting more genetic information into a shorter amount of genetic material.[3]
Literatureedit
^Wu B, White KA (December 2007). "Uncoupling RNA virus replication from transcription via the polymerase: functional and evolutionary insights". The EMBO Journal. 26 (24): 5120–30. doi:10.1038/sj.emboj.7601931. PMC2140117. PMID 18034156.
^Le, TM; Wong, HH; Tay, FP; Fang, S; Keng, CT; Tan, YJ; Liu, DX (Aug 2007). "Expression, post-translational modification and biochemical characterization of proteins encoded by subgenomic mRNA8 of the severe acute respiratory syndrome coronavirus". FEBS J. 274 (16): 4211–22. doi:10.1111/j.1742-4658.2007.05947.x. PMC7164070. PMID 17645546.
^Xu W, White KA (February 2008). "Subgenomic mRNA transcription in an aureusvirus: down-regulation of transcription and evolution of regulatory RNA elements". Virology. 371 (2): 430–8. doi:10.1016/j.virol.2007.09.035. PMID 17988704.
December 15, 2023
subgenomic, mrna, single, guide, guide, data, structure, nested, model, essentially, smaller, sections, original, transcribed, template, strand, contents, positive, sense, viral, result, examples, literature3, editduring, transcription, original, template, str. For the single guide RNA see guide RNA For the data structure see nested set model Subgenomic mRNAs are essentially smaller sections of the original transcribed template strand Contents 1 3 to 5 DNA or RNA 2 5 to 3 positive sense viral RNA 3 Result 4 Examples 5 Literature3 to 5 DNA or RNA editDuring transcription the original template strand is usually read from the 3 to the 5 end from beginning to end Subgenomic mRNAs are created when transcription begins at the 3 end of the template strand or 5 of the to be newly synthesized template and begins to copy towards the 5 end of the template strand before jumping to the end of the template and copying the last nucleotides of the 5 end of the template finishing the 3 tail for the newly created strand As a result the translated strand will have a similar 5 end to varying degrees with the original template depending on which part of the template the transcription jumped over and a similar 3 end to the template 1 5 to 3 positive sense viral RNA editPositive sense 5 to 3 viral RNA which may be directly translated into the desired viral proteins undergoes a similar process as described in 3 to 5 Portions of the viral RNA may be skipped during translation Result editThe result is that many different proteins can be created from the same mRNA strand with similar 5 ends to varying degrees and same 3 ends Or different proteins can be created with positive sense viral RNA The 5 section on the newly created strand matches that of the template strand and this section on the template strand is referred to as the nested set 2 3 5 GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACGTTATTTCTGCGCGGAAAAAAAAA Original template Strand 5 3 GCCGCCCCGTATCGATCGTAGCGCACGTTATATATAC AAAAAAAAA GCCGCCCCGTATCGATCGTAGCGCAC AAAAAAAAA Subgenomic mRNA GCCGCCCCGTAT AAAAAAAAA GCCGCCCCGTAT Nested Set indicates jumps Examples editThis complex method of transcription is generally restricted to viruses especially those of the single stranded positive sense RNA or Class IV viruses using the Baltimore Classification System e g viruses of the order Nidovirales It is primarily used for compacting more genetic information into a shorter amount of genetic material 3 Literature edit Wu B White KA December 2007 Uncoupling RNA virus replication from transcription via the polymerase functional and evolutionary insights The EMBO Journal 26 24 5120 30 doi 10 1038 sj emboj 7601931 PMC 2140117 PMID 18034156 Le TM Wong HH Tay FP Fang S Keng CT Tan YJ Liu DX Aug 2007 Expression post translational modification and biochemical characterization of proteins encoded by subgenomic mRNA8 of the severe acute respiratory syndrome coronavirus FEBS J 274 16 4211 22 doi 10 1111 j 1742 4658 2007 05947 x PMC 7164070 PMID 17645546 Xu W White KA February 2008 Subgenomic mRNA transcription in an aureusvirus down regulation of transcription and evolution of regulatory RNA elements Virology 371 2 430 8 doi 10 1016 j virol 2007 09 035 PMID 17988704 Retrieved from https en wikipedia org w index php title Subgenomic mRNA amp oldid 1119786966, wikipedia, wiki, book, books, library,
