fbpx
Wikipedia

Sticky and blunt ends

DNA ends refer to the properties of the ends of linear DNA molecules, which in molecular biology are described as "sticky" or "blunt" based on the shape of the complementary strands at the terminus. In sticky ends, one strand is longer than the other (typically by at least a few nucleotides), such that the longer strand has bases which are left unpaired. In blunt ends, both strands are of equal length – i.e. they end at the same base position, leaving no unpaired bases on either strand.

The concept is used in molecular biology, in cloning, or when subcloning insert DNA into vector DNA. Such ends may be generated by restriction enzymes that break the molecule's phosphodiester backbone at specific locations, which themselves belong to a larger class of enzymes called exonucleases and endonucleases. A restriction enzyme that cuts the backbones of both strands at non-adjacent locations leaves a staggered cut, generating two overlapping sticky ends, while an enzyme that makes a straight cut (at locations directly across from each other on both strands) generates two blunt ends.[1]

Single-stranded DNA molecules edit

A single-stranded non-circular DNA molecule has two non-identical ends, the 3' end and the 5' end (usually pronounced "three prime end" and "five prime end"). The numbers refer to the numbering of carbon atoms in the deoxyribose, which is a sugar forming an important part of the backbone of the DNA molecule. In the backbone of DNA the 5' carbon of one deoxyribose is linked to the 3' carbon of another by a phosphodiester bond linkage. The 5' carbon of this deoxyribose is again linked to the 3' carbon of the next, and so forth.

Variations in double-stranded molecules edit

When a molecule of DNA is double stranded, as DNA usually is, the two strands run in opposite directions. Therefore, one end of the molecule will have the 3' end of strand 1 and the 5' end of strand 2, and vice versa in the other end. However, the fact that the molecule is two stranded allows numerous different variations.

Blunt ends edit

The simplest DNA end of a double stranded molecule is called a blunt end. Blunt ends are also known as non-cohesive ends. In a blunt-ended molecule, both strands terminate in a base pair. Blunt ends are not always desired in biotechnology since when using a DNA ligase to join two molecules into one, the yield is significantly lower with blunt ends. When performing subcloning, it also has the disadvantage of potentially inserting the insert DNA in the opposite orientation desired. On the other hand, blunt ends are always compatible with each other. Here is an example of a small piece of blunt-ended DNA:

5'-GATCTGACTGATGCGTATGCTAGT-3' 3'-CTAGACTGACTACGCATACGATCA-5' 

Overhangs and sticky ends edit

Non-blunt ends are created by various overhangs. An overhang is a stretch of unpaired nucleotides in the end of a DNA molecule. These unpaired nucleotides can be in either strand, creating either 3' or 5' overhangs. These overhangs are in most cases palindromic.

The simplest case of an overhang is a single nucleotide. This is most often adenine and is created as a 3' overhang by some DNA polymerases. Most commonly this is used in cloning PCR products created by such an enzyme. The product is joined with a linear DNA molecule with a 3' thymine overhang. Since adenine and thymine form a base pair, this facilitates the joining of the two molecules by a ligase, yielding a circular molecule. Here is an example of an A-overhang:

5'-ATCTGACTA-3' 3'-TAGACTGA -5' 

Longer overhangs are called cohesive ends or sticky ends. They are most often created by restriction endonucleases when they cut DNA. Very often they cut the two DNA strands four base pairs from each other, creating a four-base 3' overhang in one molecule and a complementary 3' overhang in the other. These ends are called cohesive since they are easily joined back together by a ligase.

For example, these two "sticky" ends are compatible:

5'-ATCTGACT GATGCGTATGCT-3' 3'-TAGACTGACTACG CATACGA-5' 

Also, since different restriction endonucleases usually create different overhangs, it is possible to create a plasmid by excising a piece of DNA (using a different enzyme for each end) and then joining it to another DNA molecule with ends trimmed by the same enzymes. Since the overhangs have to be complementary in order for the ligase to work, the two molecules can only join in one orientation. This is often highly desirable in molecular biology.

Frayed ends edit

Across from each single strand of DNA, we typically see adenine pair with thymine, and cytosine pair with guanine to form a parallel complementary strand as described below. Two nucleotide sequences which correspond to each other in this manner are referred to as complementary:

5'-ATCTGACT-3' 3'-TAGACTGA-5' 
 

A frayed end refers to a region of a double stranded (or other multi-stranded) DNA molecule near the end with a significant proportion of non-complementary sequences; that is, a sequence where nucleotides on the adjacent strands do not match up correctly:

5'-ATCTGACTAGGCA-3' 3'-TAGACTGACTACG-5' 

The term "frayed" is used because the incorrectly matched nucleotides tend to avoid bonding, thus appearing similar to the strands in a fraying piece of rope.

Although non-complementary sequences are also possible in the middle of double stranded DNA, mismatched regions away from the ends are not referred to as "frayed".

Discovery edit

Ronald W. Davis first discovered sticky ends as the product of the action of EcoRI, the restriction endonuclease.[2]

Strength edit

Sticky end links are different in their stability. Free energy of formation can be measured to estimate stability. Free energy approximations can be made for different sequences from data related to oligonucleotide UV thermal denaturation curves.[3] Also predictions from molecular dynamics simulations show that some sticky end links are much stronger in stretch than the others.[4]

References edit

  • Sambrook, Joseph; David Russell (2001). Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press, ISBN 0879695765.
  1. ^ Sullivan, Mary (17 May 2016). Ball. Houghton Mifflin Harcourt Publishing Company. ISBN 9780544819016. OCLC 949423125.
  2. ^ The Gruber Foundation Homepage | The Gruber Foundation 2012-05-11 at the Wayback Machine
  3. ^ John SantaLucia Jr. (1997). "A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics". Proceedings of the National Academy of Sciences of the USA. 95 (4): 1460–1465. doi:10.1073/pnas.95.4.1460. PMC 19045. PMID 9465037.
  4. ^ Ehsan Ban and Catalin R Picu (2014). "Strength of DNA Sticky End Links". Biomacromolecules. 15 (1): 143–149. doi:10.1021/bm401425k. PMID 24328228.

sticky, blunt, ends, this, article, needs, additional, citations, verification, please, help, improve, this, article, adding, citations, reliable, sources, unsourced, material, challenged, removed, find, sources, news, newspapers, books, scholar, jstor, februa. This article needs additional citations for verification Please help improve this article by adding citations to reliable sources Unsourced material may be challenged and removed Find sources Sticky and blunt ends news newspapers books scholar JSTOR February 2017 Learn how and when to remove this template message DNA ends refer to the properties of the ends of linear DNA molecules which in molecular biology are described as sticky or blunt based on the shape of the complementary strands at the terminus In sticky ends one strand is longer than the other typically by at least a few nucleotides such that the longer strand has bases which are left unpaired In blunt ends both strands are of equal length i e they end at the same base position leaving no unpaired bases on either strand The concept is used in molecular biology in cloning or when subcloning insert DNA into vector DNA Such ends may be generated by restriction enzymes that break the molecule s phosphodiester backbone at specific locations which themselves belong to a larger class of enzymes called exonucleases and endonucleases A restriction enzyme that cuts the backbones of both strands at non adjacent locations leaves a staggered cut generating two overlapping sticky ends while an enzyme that makes a straight cut at locations directly across from each other on both strands generates two blunt ends 1 Contents 1 Single stranded DNA molecules 2 Variations in double stranded molecules 2 1 Blunt ends 2 2 Overhangs and sticky ends 2 3 Frayed ends 3 Discovery 4 Strength 5 ReferencesSingle stranded DNA molecules editA single stranded non circular DNA molecule has two non identical ends the 3 end and the 5 end usually pronounced three prime end and five prime end The numbers refer to the numbering of carbon atoms in the deoxyribose which is a sugar forming an important part of the backbone of the DNA molecule In the backbone of DNA the 5 carbon of one deoxyribose is linked to the 3 carbon of another by a phosphodiester bond linkage The 5 carbon of this deoxyribose is again linked to the 3 carbon of the next and so forth Variations in double stranded molecules editWhen a molecule of DNA is double stranded as DNA usually is the two strands run in opposite directions Therefore one end of the molecule will have the 3 end of strand 1 and the 5 end of strand 2 and vice versa in the other end However the fact that the molecule is two stranded allows numerous different variations Blunt ends edit The simplest DNA end of a double stranded molecule is called a blunt end Blunt ends are also known as non cohesive ends In a blunt ended molecule both strands terminate in a base pair Blunt ends are not always desired in biotechnology since when using a DNA ligase to join two molecules into one the yield is significantly lower with blunt ends When performing subcloning it also has the disadvantage of potentially inserting the insert DNA in the opposite orientation desired On the other hand blunt ends are always compatible with each other Here is an example of a small piece of blunt ended DNA 5 GATCTGACTGATGCGTATGCTAGT 3 3 CTAGACTGACTACGCATACGATCA 5 Overhangs and sticky ends edit Non blunt ends are created by various overhangs An overhang is a stretch of unpaired nucleotides in the end of a DNA molecule These unpaired nucleotides can be in either strand creating either 3 or 5 overhangs These overhangs are in most cases palindromic The simplest case of an overhang is a single nucleotide This is most often adenine and is created as a 3 overhang by some DNA polymerases Most commonly this is used in cloning PCR products created by such an enzyme The product is joined with a linear DNA molecule with a 3 thymine overhang Since adenine and thymine form a base pair this facilitates the joining of the two molecules by a ligase yielding a circular molecule Here is an example of an A overhang 5 ATCTGACTA 3 3 TAGACTGA 5 Longer overhangs are called cohesive ends or sticky ends They are most often created by restriction endonucleases when they cut DNA Very often they cut the two DNA strands four base pairs from each other creating a four base 3 overhang in one molecule and a complementary 3 overhang in the other These ends are called cohesive since they are easily joined back together by a ligase For example these two sticky ends are compatible 5 ATCTGACT GATGCGTATGCT 3 3 TAGACTGACTACG CATACGA 5 Also since different restriction endonucleases usually create different overhangs it is possible to create a plasmid by excising a piece of DNA using a different enzyme for each end and then joining it to another DNA molecule with ends trimmed by the same enzymes Since the overhangs have to be complementary in order for the ligase to work the two molecules can only join in one orientation This is often highly desirable in molecular biology Frayed ends edit Across from each single strand of DNA we typically see adenine pair with thymine and cytosine pair with guanine to form a parallel complementary strand as described below Two nucleotide sequences which correspond to each other in this manner are referred to as complementary 5 ATCTGACT 3 3 TAGACTGA 5 nbsp A frayed end refers to a region of a double stranded or other multi stranded DNA molecule near the end with a significant proportion of non complementary sequences that is a sequence where nucleotides on the adjacent strands do not match up correctly 5 ATCTGACTAGGCA 3 3 TAGACTGA CTACG 5 The term frayed is used because the incorrectly matched nucleotides tend to avoid bonding thus appearing similar to the strands in a fraying piece of rope Although non complementary sequences are also possible in the middle of double stranded DNA mismatched regions away from the ends are not referred to as frayed Discovery editRonald W Davis first discovered sticky ends as the product of the action of EcoRI the restriction endonuclease 2 Strength editSticky end links are different in their stability Free energy of formation can be measured to estimate stability Free energy approximations can be made for different sequences from data related to oligonucleotide UV thermal denaturation curves 3 Also predictions from molecular dynamics simulations show that some sticky end links are much stronger in stretch than the others 4 References edit nbsp Wikidata has the property nbsp produces cohesive end P4914 see uses Sambrook Joseph David Russell 2001 Molecular Cloning A Laboratory Manual New York Cold Spring Harbor Laboratory Press ISBN 0879695765 Sullivan Mary 17 May 2016 Ball Houghton Mifflin Harcourt Publishing Company ISBN 9780544819016 OCLC 949423125 The Gruber Foundation Homepage The Gruber Foundation Archived 2012 05 11 at the Wayback Machine John SantaLucia Jr 1997 A unified view of polymer dumbbell and oligonucleotide DNA nearest neighbor thermodynamics Proceedings of the National Academy of Sciences of the USA 95 4 1460 1465 doi 10 1073 pnas 95 4 1460 PMC 19045 PMID 9465037 Ehsan Ban and Catalin R Picu 2014 Strength of DNA Sticky End Links Biomacromolecules 15 1 143 149 doi 10 1021 bm401425k PMID 24328228 Retrieved from https en wikipedia org w index php title Sticky and blunt ends amp oldid 1209519598, wikipedia, wiki, book, books, library,

article

, read, download, free, free download, mp3, video, mp4, 3gp, jpg, jpeg, gif, png, picture, music, song, movie, book, game, games.